Review



sequence based reagents (dna oligos)  (Oligos Etc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Oligos Etc sequence based reagents (dna oligos)
    Sequence Based Reagents (Dna Oligos), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-44-0-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) - by Bioz Stars, 2026-07
    90/100 stars

    Images



    Similar Products

    e7645l sequence based reagent nebnext multiplex oligos for illumina new england biolabs  (New England Biolabs)
    99
    New England Biolabs e7645l sequence based reagent nebnext multiplex oligos for illumina new england biolabs
    E7645l Sequence Based Reagent Nebnext Multiplex Oligos For Illumina New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/10__7554_slash_elife__98058-197-154-158?v=New+England+Biolabs
    Average 99 stars, based on 1 article reviews
    e7645l sequence based reagent nebnext multiplex oligos for illumina new england biolabs - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos)  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos)
    Sequence Based Reagents (Dna Oligos), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-44-0-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos) gctatttacctacacaaaccaattt  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos) gctatttacctacacaaaccaattt

    Sequence Based Reagents (Dna Oligos) Gctatttacctacacaaaccaattt, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-59-6-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) gctatttacctacacaaaccaattt - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos) ctaatacgactcactatagggctcagtagtaatagatttagttttagagct  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos) ctaatacgactcactatagggctcagtagtaatagatttagttttagagct

    Sequence Based Reagents (Dna Oligos) Ctaatacgactcactatagggctcagtagtaatagatttagttttagagct, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-50-6-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) ctaatacgactcactatagggctcagtagtaatagatttagttttagagct - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos) ctaatacgactcactataggttttcaataacccaaacatagttttagagct  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos) ctaatacgactcactataggttttcaataacccaaacatagttttagagct

    Sequence Based Reagents (Dna Oligos) Ctaatacgactcactataggttttcaataacccaaacatagttttagagct, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-55-6-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) ctaatacgactcactataggttttcaataacccaaacatagttttagagct - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos) gfp-ha-vasa n-fw  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos) gfp-ha-vasa n-fw

    Sequence Based Reagents (Dna Oligos) Gfp Ha Vasa N Fw, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-63-19-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) gfp-ha-vasa n-fw - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos) caggaaacagctatgac  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos) caggaaacagctatgac

    Sequence Based Reagents (Dna Oligos) Caggaaacagctatgac, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-68-6-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) caggaaacagctatgac - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence based reagents (dna oligos) accacgacgtgatcca  (Oligos Etc)
    90
    Oligos Etc sequence based reagents (dna oligos) accacgacgtgatcca

    Sequence Based Reagents (Dna Oligos) Accacgacgtgatcca, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+based+reagents+%28dna+oligos%29/pmc05844692-60-6-4?v=Oligos+Etc
    Average 90 stars, based on 1 article reviews
    sequence based reagents (dna oligos) accacgacgtgatcca - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: The genome of the Hi5 germ cell line from Trichoplusia ni , an agricultural pest and novel model for small RNA biology

    doi: 10.7554/eLife.31628

    Figure Lengend Snippet:

    Article Snippet: sequence based reagents (DNA oligos) , GCTATTTACCTACACAAACCAATTT , this paper , , ciwi deletion forward , , Forward primer for ciwi deletion detection , .

    Techniques: Stable Transfection, Recombinant, Synthesized, Sequencing, In Vitro, Mutagenesis, Knock-Out, Amplification, Sample Prep, Isolation, Transfection, Gel Extraction, PCR Cloning, Software, CRISPR

    Journal: eLife

    Article Title: The genome of the Hi5 germ cell line from Trichoplusia ni , an agricultural pest and novel model for small RNA biology

    doi: 10.7554/eLife.31628

    Figure Lengend Snippet:

    Article Snippet: sequence based reagents (DNA oligos) , CtaatacgactcactataGGCATTTTGTGTTTCTCAACACgttttagagct , this paper , , T7-sgRNA1 forward primer , , Forward primer for sgRNA in vitro transcription template generation , .

    Techniques: Stable Transfection, Recombinant, Synthesized, Sequencing, In Vitro, Mutagenesis, Knock-Out, Amplification, Sample Prep, Isolation, Transfection, Gel Extraction, PCR Cloning, Software, CRISPR

    Journal: eLife

    Article Title: The genome of the Hi5 germ cell line from Trichoplusia ni , an agricultural pest and novel model for small RNA biology

    doi: 10.7554/eLife.31628

    Figure Lengend Snippet:

    Article Snippet: sequence based reagents (DNA oligos) , CtaatacgactcactataGGTTTTCAATAACCCAAACATAgttttagagct , this paper , , T7-sgRNA6 forward primer , , Forward primer for sgRNA in vitro transcription template generation , .

    Techniques: Stable Transfection, Recombinant, Synthesized, Sequencing, In Vitro, Mutagenesis, Knock-Out, Amplification, Sample Prep, Isolation, Transfection, Gel Extraction, PCR Cloning, Software, CRISPR

    Journal: eLife

    Article Title: The genome of the Hi5 germ cell line from Trichoplusia ni , an agricultural pest and novel model for small RNA biology

    doi: 10.7554/eLife.31628

    Figure Lengend Snippet:

    Article Snippet: sequence based reagents (DNA oligos) , CAGGAAACAGCTATGAC , this paper , , M13 Rv , , Reverse primer for colony PCR , .

    Techniques: Stable Transfection, Recombinant, Synthesized, Sequencing, In Vitro, Mutagenesis, Knock-Out, Amplification, Sample Prep, Isolation, Transfection, Gel Extraction, PCR Cloning, Software, CRISPR

    Journal: eLife

    Article Title: The genome of the Hi5 germ cell line from Trichoplusia ni , an agricultural pest and novel model for small RNA biology

    doi: 10.7554/eLife.31628

    Figure Lengend Snippet:

    Article Snippet: sequence based reagents (DNA oligos) , ACCACGACGTGATCCA , this paper , , ciwi d eletion reverse , , Reverse primer for ciwi deletion detection , .

    Techniques: Stable Transfection, Recombinant, Synthesized, Sequencing, In Vitro, Mutagenesis, Knock-Out, Amplification, Sample Prep, Isolation, Transfection, Gel Extraction, PCR Cloning, Software, CRISPR